Physics, asked by isabellagarcia2124, 3 months ago

I NEED HELP PLEASE!!!!!!!!!!!! HURRY UP PLEASE!!!!!

Attachments:

Answers

Answered by pinky22267

0

Answer:

the picture is blur and small keep it longer and proper...

Previous Question

Next Question

Similar questions

Math, 1 month ago

If 12x + 17y = 11 and 7x – 8y = 4, then what is the value of x + y? (A) 1 (B) 7 (C) 15 (D) 4...

English, 1 month ago

places. TASK 2 Directions: Summarize the story below by answering the following questions based on the given elements. (5 POINTS) The Lion and the Hare By Aesop A Lion came across a Hare, who was fast asleep. He was just in the act of seizing her, when a fine young Hart trotz by, and he left the Hare to follow him. The Hare, scared by the noise, awoke and scudded away. The Lion was una after a...

Science, 1 month ago

Why agriculture is a profitable trade in plains? Explain. i...

Biology, 3 months ago

*Q1. You have the following sequence on a plasmid: 5′- ATGCTAGCAGAATTCTAGCTACGAT (only one of the strands is shown) You cleave the region indicated (in bold) with the appropriate restriction enzyme, then fill in the overhangs with DNA polymerase, ligate, and reclone. You then aliquot the resulting DNA to three. In the first tube, digest the plasmid DNA with XmnI (recognition sequence...

English, 3 months ago

plz help me this is due in 30 mins...

Computer Science, 9 months ago

name any device that contains file...

Chemistry, 9 months ago

any trisodium acetate exist ?

Math, 9 months ago

Keisha had $405 in her bank account. In one month, she made 4 withdrawals of $45 each. What is the balance in her account?