English, asked by arshadbagwan800, 3 months ago

(1) Write a letter to your friend discussing about features of the summer camp and
inviting him for joining it.

Answers

Answered by nadeemattar1980

0

Answer:

l couldn't get your question dear ,could pls mention clearly

Previous Question

Next Question

Similar questions

English, 1 month ago

He said, "I’ll use the one-side-used papers for my accounts." (Rewrite the sentence in Indirect Speech)...

Hindi, 1 month ago

व्यथा का विशेषण बताईए...

English, 1 month ago

when the narrator enters the bank...

Physics, 3 months ago

I NEED HELP PLEASE!!!!!!!!!!!! HURRY UP PLEASE!!!!!

Biology, 3 months ago

*Q1. You have the following sequence on a plasmid: 5′- ATGCTAGCAGAATTCTAGCTACGAT (only one of the strands is shown) You cleave the region indicated (in bold) with the appropriate restriction enzyme, then fill in the overhangs with DNA polymerase, ligate, and reclone. You then aliquot the resulting DNA to three. In the first tube, digest the plasmid DNA with XmnI (recognition sequence...

Computer Science, 9 months ago

name any device that contains file...

Chemistry, 9 months ago

any trisodium acetate exist ?

Math, 9 months ago

Keisha had $405 in her bank account. In one month, she made 4 withdrawals of $45 each. What is the balance in her account?