Math, asked by Anonymous, 10 months ago

Sin4x + sin2 x Simplify I want this answer to check Please do it

Answers

Answered by Prakritipriya123

1

Answer:

Step-by-step explanation:

Attachments:

Previous Question

Next Question

Similar questions

Biology, 4 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 (a) What would be the first 5 bases in the 3 end of the complementary strand? (b) What would be the 10 bases of the 5 end of the complementary strand?

Social Sciences, 4 months ago

1. Draw pictures of different modes of worship and prepare a small booklet on it for your school library.

Social Sciences, 4 months ago

State affecting the factor climate...

Math, 10 months ago

$y ^{2} 3 \sqrt{5} y - 5$ ...

Geography, 10 months ago

which are the two islands groups that belongs to our country?

History, 1 year ago

Ok so I need two rachna of Subhadra kumari Chauhan...

Hindi, 1 year ago

ईश्वर के प्रेम को पाने के लिए व्यक्ति का मन किन किन स्थितियों से गुजरता है।...

Art, 1 year ago

Hi friend plese help me my question is in 21st century WhatsApp changed our life. Write its advantages and disadvantages. geys please help...