Computer Science, asked by SURYANSHUGUPTA, 9 months ago

the process of setting number of values in some order

Answers

Answered by ITZSAVANTH

4

Answer:

The process of setting number of values in order is called as Sequence.

Explanation:

Hope it might helps you ♥️ .

If you like the answer mark me as brainlist ♥️.

Thank you ♥️.

Previous Question

Next Question

Similar questions

Computer Science, 4 months ago

Find out the total no of comparisons to search the following pattern in the given text using Boyer Moore algorithm for string matching. Text: GTTATAGC T GATCGCGGCGTAGCGGCGAA Pattern: GTAGCGGC G...

English, 4 months ago

Roofs of the houses in the olden thatched with...

Math, 4 months ago

5. The different modes of transport used by the students of a school is given below. Represent this data by a pie chart: Walking - 40% By cycle - 20% By bus -30% By car -10...

Geography, 9 months ago

Explain the variors of soil conservation.

Math, 9 months ago

Please give me answers of my questions ...

Social Sciences, 1 year ago

what is the main aim of production? what are the initial requirements for production?explain it?

Biology, 1 year ago

What is Epiblema (A) epidermis of root (B)epidermis of flower (C) epidermis of leaf (D) epidermis of stem...

Math, 1 year ago

what we subtract in2by5 that get answer 1 by4...