Question

The sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the other strand be? Start with the top of the strand and work down.

Answer 1

The sequence of nucleotides on the other strand will be 5' TAAGCCGATAAATGCTAACGGTA 3'.

In determining the nucleotides on the second strand, the following rules should be kept in mind:

• Two strands in the DNA are complementary to each other and if the polarity of one strand is 3' to 5' then the polarity of the other strand will be 5' to 3'
• Nucleotides are paired with hydrogen bonds according to the rule: Adenosine binds with Thymine with 2 hydrogen bonds and Cytosine binds with Guanine with 3 hydrogen bonds.
• We will assign the first strand polarity as follows:

        3' ATTCGGCTATTTACGATTGCCAT 5'

• So the second strand will be complementary to the first according to the complementarity rule and will be as follows:

        5' TAAGCCGATAAATGCTAACGGTA 3'.