Biology, asked by jesstoopretty, 6 months ago

What is the corresponding mRNA sequence from the DNA strand CGA TTA CAG

Answers

Answered by snitishkumar011
2

Explanation:

Problem Set 4 Answers

 

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

Similar questions