Chemistry, asked by kavitha2057, 4 months ago

What is the mean of varnin subject is Telugu​

Answers

Answered by Tashmeela007
1

Answer:Nouns are the subject of a sentence. Common Noun - A noun that does not name a specific person, place or thing. Proper Noun - The pronoun is a word used in this

,,,,

Explanation:

Answered by aftersparks
2

here is your answer. hope it helps!

i'd like to be friends too

Attachments:
Previous Question
Next Question
Similar questions
Math, 2 months ago
24. In parallelogram ABCD, LA= 2B +50° then find all angles of ABCD. 25. In A ABC is an altitude to the base BC. BE is an altitude to the base AC. If AD = 14, BC = 24 and AC = 35, then find BE. 26. The lenght of chord of P-centered circle is 16 cm and distance betweeen chord and center is 6 cm then find radius. ફેન્ડસ કલાસીસ 2021191 Be a Friend with "Friends" In which chapter I will...
Math, 2 months ago
Koi batayega yeh kaise possible h ?​
Social Sciences, 2 months ago
किसी भी पांच सामाजिक और प्रशासनिक सुधारों की व्याख्या करें जिसे नेपोलियन द्वारा निर्मित इन क्षेत्रों में लागू किया गया​...
Science, 4 months ago
 A body is allowed to fall freely from height h , under gravitational force of the earth. It's velocity after travelling the height will be- 1. v =u+gt 2. v = 1/2 g t2 3. v =√ 2gh 4. v = √ u2+ 2gh ​...
Math, 4 months ago
three squares are joined together as shown in the given figure below their sides are 4 cm 10 cm and 3 cm find the area of the figure​...
Biology, 10 months ago
Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.
Biology, 10 months ago
(a) Mention the difference in the mode of action of exonuclease and endonuclease. (b) How does restriction endonuclease function?
Science, 10 months ago
Differentiate between sperm and ovary...