Chemistry, asked by kavitha2057, 2 months ago

What is the mean of varnin subject is Telugu​

Answers

Answered by Tashmeela007
1

Answer:Nouns are the subject of a sentence. Common Noun - A noun that does not name a specific person, place or thing. Proper Noun - The pronoun is a word used in this

,,,,

Explanation:

Answered by aftersparks
2

here is your answer. hope it helps!

i'd like to be friends too

Attachments:
Previous Question
Next Question
Similar questions
Computer Science, 1 month ago
name any two software package for graphic and designing​...
Math, 1 month ago
the area of a Trapezium is 45 CM 2 and the length of one of the parallel sides is 16 cm and its height is 8 cm find the length of the Other parallel side​...
Physics, 1 month ago
A rise in temperature usually decreases the elasticity of the material. This is due to *​...
Science, 2 months ago
 A body is allowed to fall freely from height h , under gravitational force of the earth. It's velocity after travelling the height will be- 1. v =u+gt 2. v = 1/2 g t2 3. v =√ 2gh 4. v = √ u2+ 2gh ​...
Math, 2 months ago
three squares are joined together as shown in the given figure below their sides are 4 cm 10 cm and 3 cm find the area of the figure​...
Biology, 8 months ago
Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.
Biology, 8 months ago
(a) Mention the difference in the mode of action of exonuclease and endonuclease. (b) How does restriction endonuclease function?
Science, 8 months ago
Differentiate between sperm and ovary...