English, asked by sk6991703, 3 months ago

waiting for the right thought.

Answers

Answered by sarjana78

0

Good Morning ....

What are u epwaiting for?? What do u mean by right thought???

Previous Question

Next Question

Similar questions

Math, 1 month ago

a shoe shop wanted to record the sales of shoe and slippers of various size on a particular day the data is given below draw a bar graph...

English, 1 month ago

explain in details about the various factors affecting building economy?

Science, 1 month ago

explain the characteristics of expository style essay...

Chemistry, 3 months ago

What is the mean of varnin subject is Telugu...

Science, 3 months ago

A body is allowed to fall freely from height h , under gravitational force of the earth. It's velocity after travelling the height will be- 1. v =u+gt 2. v = 1/2 g t2 3. v =√ 2gh 4. v = √ u2+ 2gh ...

English, 9 months ago

Summary of Elizabeth speaks her mind, from the book my canvas...

Biology, 9 months ago

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.

Biology, 9 months ago

(a) Mention the difference in the mode of action of exonuclease and endonuclease. (b) How does restriction endonuclease function?