English, asked by sk6991703, 4 months ago

waiting for the right thought.

Answers

Answered by sarjana78

0

Good Morning ....

What are u epwaiting for?? What do u mean by right thought???

Previous Question

Next Question

Similar questions

Environmental Sciences, 2 months ago

Can the value of clean safe water be determined in terms of time and effort needed to gather and store the resource?

English, 2 months ago

One should always get up from get up from a meal feeling one Leould eat a little more! (Pick out the non- finite verb) ...

Math, 2 months ago

solve please -3 = r/6. r = ___...

Chemistry, 4 months ago

What is the mean of varnin subject is Telugu...

Science, 4 months ago

A body is allowed to fall freely from height h , under gravitational force of the earth. It's velocity after travelling the height will be- 1. v =u+gt 2. v = 1/2 g t2 3. v =√ 2gh 4. v = √ u2+ 2gh ...

English, 10 months ago

Summary of Elizabeth speaks her mind, from the book my canvas...

Biology, 10 months ago

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.

Biology, 10 months ago

(a) Mention the difference in the mode of action of exonuclease and endonuclease. (b) How does restriction endonuclease function?