Math, asked by sumitrajotia1983, 2 months ago

The smallest whole no is

Answers

Answered by satyamamatha

1

Answer:

o is smallest whole number

Answered by hritvishah14

0

Answer:

0 is the smallest whole number.

Step-by-step explanation:

Previous Question

Next Question

Similar questions

Hindi, 1 month ago

Essay Writing नारी शिद्दा का महत्व...

Hindi, 1 month ago

ammi ne khansan ko Kya khana bnnane ko kaha in Hindi subject ...

English, 1 month ago

I was standing in front of a river flowing along a great plain. An ancient temple was situated on its bank. Most of the area around the temple looked serene and divine. I thought of going inside the temple to offer my prayers. When I started walking towards it, I saw a woman keenly looking at me. “Do you know me?” I asked her when she continued looking at me. “You looked like my little...

English, 2 months ago

waiting for the right thought.

Chemistry, 2 months ago

What is the mean of varnin subject is Telugu...

English, 7 months ago

Summary of Elizabeth speaks her mind, from the book my canvas...

Biology, 7 months ago

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.

Biology, 7 months ago

(a) Mention the difference in the mode of action of exonuclease and endonuclease. (b) How does restriction endonuclease function?