Math, asked by sumitrajotia1983, 6 months ago

The smallest whole no is

Answers

Answered by satyamamatha

1

Answer:

o is smallest whole number

Answered by hritvishah14

0

Answer:

0 is the smallest whole number.

Step-by-step explanation:

Previous Question

Next Question

Similar questions

Hindi, 2 months ago

गणित विषय की परीक्षा के पश्चात दो मित्रों के बीच संवाद लिखें। ...

English, 2 months ago

what was the first transformation ...

Hindi, 2 months ago

राष्ट्रभाषा को अंग्रेजी में ऑफिशियल लैंग्वेज कहते हैं सत्य आ सकते हैं...

English, 6 months ago

waiting for the right thought.

Chemistry, 6 months ago

What is the mean of varnin subject is Telugu...

English, 11 months ago

Summary of Elizabeth speaks her mind, from the book my canvas...

Biology, 11 months ago

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.

Biology, 11 months ago

(a) Mention the difference in the mode of action of exonuclease and endonuclease. (b) How does restriction endonuclease function?