Physics, asked by sbahduhrani, 5 months ago

what is the supply to be given to the Vcc input of the 8086?

Answers

Answered by pottireshma355

0

Answer:

It uses a 5V DC supply for its operation. The 8086 uses 20-line address bus.

Answered by Sashtika

0

not sure about the answer ..

Attachments:

Previous Question

Next Question

Similar questions

Hindi, 2 months ago

दिये गाये मुहावरे का चैन बनाकर फिर्से लिखिये :: रुसासा होना, हामी bharna , पेर पाकडना...

English, 2 months ago

write a story of monkey and the capseller...

Science, 2 months ago

witte briefly how in detail how to purify drinking water supplying to the city.

Math, 5 months ago

The smallest whole no is ...

English, 5 months ago

waiting for the right thought.

Biology, 10 months ago

(a) Why is fertilisation in an angiosperm referred to as double fertilisation? Mention the ploidy of the cells involved. (b) Draw a neat labelled sketch of L.S. of an endospermous monocot seed.

English, 10 months ago

Summary of Elizabeth speaks her mind, from the book my canvas...

Biology, 10 months ago

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.