Physics, asked by sbahduhrani, 4 months ago

what is the supply to be given to the Vcc input of the 8086?

Answers

Answered by pottireshma355

0

Answer:

It uses a 5V DC supply for its operation. The 8086 uses 20-line address bus.

Answered by Sashtika

0

not sure about the answer ..

Attachments:

Previous Question

Next Question

Similar questions

Math, 2 months ago

The volume of a cylinder whose diameter is equal to its height is(consider height as h) *...

English, 2 months ago

We belived the boy guilty. complex...

History, 2 months ago

what was the role of santiniketan in the spread of education...

Math, 4 months ago

The smallest whole no is ...

English, 4 months ago

waiting for the right thought.

Biology, 9 months ago

(a) Why is fertilisation in an angiosperm referred to as double fertilisation? Mention the ploidy of the cells involved. (b) Draw a neat labelled sketch of L.S. of an endospermous monocot seed.

English, 9 months ago

Summary of Elizabeth speaks her mind, from the book my canvas...

Biology, 9 months ago

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.