Math, asked by laibatheprincess704, 2 months ago

show that the diagonals of the parallelogram having the vertices A(1,2) , B(4,2),C(-1,-3) and D (-4,-3) bisect each other

Answers

Answered by wwwvinayak68

0

Answer:

download and ask questions to best IITIANS and best teachers for absolutely FREE go and download and achieve your carrier..

https://app.findfilo.com/download/Rj2f

Previous Question

Next Question

Similar questions

Hindi, 1 month ago

) क ृ वषकात्दरू े ककम्ततष्ठतत? please let me this question answer...

Social Sciences, 1 month ago

Draw a labelled diagram of the layers of atmosphere...

Math, 1 month ago

pythagoras propery is related to triangle with one angle of measure _______ degree...

Physics, 2 months ago

what is the supply to be given to the Vcc input of the 8086?

Math, 2 months ago

The smallest whole no is ...

Biology, 8 months ago

(a) Why is fertilisation in an angiosperm referred to as double fertilisation? Mention the ploidy of the cells involved. (b) Draw a neat labelled sketch of L.S. of an endospermous monocot seed.

English, 8 months ago

Summary of Elizabeth speaks her mind, from the book my canvas...

Biology, 8 months ago

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.