Math, asked by laibatheprincess704, 5 months ago

show that the diagonals of the parallelogram having the vertices A(1,2) , B(4,2),C(-1,-3) and D (-4,-3) bisect each other

Answers

Answered by wwwvinayak68

0

Answer:

download and ask questions to best IITIANS and best teachers for absolutely FREE go and download and achieve your carrier..

https://app.findfilo.com/download/Rj2f

Previous Question

Next Question

Similar questions

English, 2 months ago

what is the meaning of buyer...

Math, 2 months ago

of an item is 50 rupees is if it is sold with the profit of 12% it is selling price is what...

English, 2 months ago

name the scientist who propounded fluid mosaic model...

Physics, 5 months ago

what is the supply to be given to the Vcc input of the 8086?

Math, 5 months ago

The smallest whole no is ...

Biology, 10 months ago

(a) Why is fertilisation in an angiosperm referred to as double fertilisation? Mention the ploidy of the cells involved. (b) Draw a neat labelled sketch of L.S. of an endospermous monocot seed.

English, 10 months ago

Summary of Elizabeth speaks her mind, from the book my canvas...

Biology, 10 months ago

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.