English, asked by rathoreaditya819, 5 months ago

which is your favourite activity ?why it is?

Answers

Answered by gnishasalo2

1

playing free fire because it so interesting

Previous Question

Next Question

Similar questions

Chemistry, 2 months ago

का पापणा५ 19. वियोजन (अपघटन) अभिक्रियाओं में अभिकारकों को तोड़ने के लिए या तो ऊष्मा अथवा प्रकाश अथवा विद्युत ऊर्जा की आवश्यकता होती है। प्रत्येक प्रकार की वियोजन अभिक्रिया जिसमें ऊष्मा, प्रकाश और विद्युत ऊर्जा की आपूर्ति की जाती है, के लिए एक-एक रासायनिक समीकरण लिखिए।...

Math, 2 months ago

what should be the least number by which when 23808 be divided,the quotient may be a perfect square? tell me it's right answer.

Computer Science, 2 months ago

Question 1 Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. • “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm? A)The empty string. B)ATGCCCTAACTAGATTAA C)ATGCCCTAA D)CCC E)ATGCCC...

Math, 5 months ago

If g(x)=(x-2)/3 then calculate the value of gg(1/2)...

Social Sciences, 5 months ago

everybody pay taxes in some form or the other how? And what is property tax...

Math, 10 months ago

111=13 112=24 113=35 114=46 115=57 119=??

Math, 10 months ago

1/2, 3/4, 5/6 vetify associativity of multiplication of rational number for the following...

English, 10 months ago

Unscramble the words of groceries logos...