Geography, asked by tanish226, 11 months ago

Which place has achieved a race distinction of having root top rain water harvesting in every house ? a) Gujarat b) Gendathur c) Rajasthan d) Tamil nadu

Answers

Answered by bhargav8936

1

Tamil nadu has achieved a race distinction of having root top rain water harvesting in every house .

Answered by Anonymous

5

Answer:

here is ur answer........

option (d) Tamilnadu

Previous Question

Next Question

Similar questions

English, 6 months ago

Hospital word register 4 words...

Social Sciences, 6 months ago

Most of the laborers like mohan depend upon from informal sector...

Math, 6 months ago

What is the sum of 104,25,-11,15...

Biology, 11 months ago

(0.68. Following sequence of RNA, when translated will form a protein molecule of amino acids. 5 GCUCGCAUGCCAGAUGUCUUCGUCCUUUAGUUUAUUAGA 3' a) 3 b) 7 c) 6 d) 9...

Physics, 11 months ago

In the figure shown the minimum value of F to be applied perpendicular to the inclined so that the block of mass 10 kg does not slides and remains in contact with inclined plane is (A)0 (B) 40 N (C) 220 N (D) 200 N ...

Social Sciences, 1 year ago

Write the priorities and development of guru movements in india...

Physics, 1 year ago

Why we have to do reconstruction after decomposition in wavelet transform?

Biology, 1 year ago

Write about agriculture activities and different crops in india...