Math, asked by akadhant, 2 days ago

7 If z  1 3i , find the modulus & amplitude of z .

Answers

Answered by itzmecutejennei

1

Answer:

amplitude of z= tan-¹(3/1)

= tan-¹(3/1)

is the correct answer

hope it helps you

Answered by nihasrajgone2005

1

Answer:

please drop some ❤️❤️❤️

Step-by-step explanation:

please f-o-l-l-o-w m-e bro please

Attachments:

Previous Question

Next Question

Similar questions

Math, 1 day ago

MCOS 6. In n th 1. Zinc and Nickel are melted and mixed together in the ratio 10:17. What is the weight of the melted mixture, if 30 kg of Zinc has been consumed in it? a) 51 kg b) 79 kg c) 81 kg d) 210 kg a c 7.

Biology, 1 day ago

2. What will be the sequence of the transcribed RNA molecule from given double stranded DNA segment? Define the polarity of these two strands as well as of the transcribed mRNA. CGATGCCTAACGACATGCGTCATTGG GCTACGGATTGCTGTACGCAGTAACC...

Math, 1 day ago

what is the additive inverse of rational number -p upon q solution ...

Geography, 2 days ago

A movement took place in the USA in the late 1950's to push for equal rights for African-Americans. This movement later came to be known as?

English, 2 days ago

it is very dark. pick out the noun or pronoun in the nominative case.Give reason also pls...

Social Sciences, 8 months ago

8.What were the policies followed by the Majoritarian Government of Srilanka?

English, 8 months ago

I do not eat peanuts _______ I am allergic to nuts ...

English, 8 months ago

write a notice informing the student about a cultural fest that is being organised in your school...