Math, asked by asnamirza446, 9 months ago

a surface is that which has _only

Answers

Answered by anupkasia

2

I cant understand...

Please ask again..

Mark as brainlist....

Answered by monika8180

4

Answer:

object

mark me as brainlist please

Previous Question

Next Question

Similar questions

English, 4 months ago

Choose the option that completes the given sentence meaningfully. The new sidewalk should make it safer to walk _____ the highway ____ night. 1 across...during 2 across...in 3 along...at 4 along...in answer please.

Physics, 4 months ago

what is combination of circuit...? (answer should be long the long and satisfying anwer will be marked as brainlist)...

Biology, 4 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 (a) What would be the first 5 bases in the 3 end of the complementary strand? (b) What would be the 10 bases of the 5 end of the complementary strand?

Math, 9 months ago

The mean of 1414 numbers is 66.Five of the numbers are 99,55,44,66 and 77.The remaining numbers are all equal. Find their value...

Math, 9 months ago

find the value using suitable property 2639x8+2639x93...

Economy, 1 year ago

what is Compect disk ?

Math, 1 year ago

Tan(90+theta)= Step by step explanation...

History, 1 year ago

in which country dog was worshipped as god?