English, asked by ravibala47, 3 months ago

Choose the option that completes the given sentence meaningfully.

The new sidewalk should make it safer to walk _ the highway night.
1 across...during
2 across...in
3 along...at
4 along...in
answer please.

Answers

Answered by sg6884018

2

Answer:

3

Explanation:

please do me a favour by marking me as the brainliest

Answered by nazia672038

0

Answer:

3 is right answer of this question

Previous Question

Next Question

Similar questions

Math, 1 month ago

the coefficient of -x is...

World Languages, 1 month ago

Spanish Formal commands...

History, 1 month ago

was the capital city of the Chandella rulers...

Physics, 3 months ago

what is combination of circuit...? (answer should be long the long and satisfying anwer will be marked as brainlist)...

Biology, 3 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 (a) What would be the first 5 bases in the 3 end of the complementary strand? (b) What would be the 10 bases of the 5 end of the complementary strand?

Math, 9 months ago

14. A person borrowed Rs 600 at the rate of 5% per annum simple interest. What amount will he pay to clear the debt after 4 years ? 5 AC...

History, 9 months ago

two features of IC analysis...

English, 9 months ago

"Mrs. Hutchinson? Oh, Mrs. Hutchinson." Thelma batted her eyes. "Naw, precious, she come on Thursday and didn't ev'n mention your name. I doubt if she ev'n knows you're on the way." "Thelma!" cried Leota staunchly. In this excerpt from "The Petrified Man," why does Leota get upset at Thelma's comment? Leota does not want Thelma to distract her customer with idle gossip. Mrs. Fletcher does...