Math, asked by binu2072, 9 months ago

If ab-16 and a-b=2 fir-
the value of (a+b)^2 and (a^2+b^2)

Answers

Answered by nehaa0704

1

Step-by-step explanation:

Your answer is in above attachment........

Hope it will help you!!!!!!

Attachments:

Previous Question

Next Question

Similar questions

Science, 4 months ago

4. identify the type ⏳ of clock...

English, 4 months ago

what is the meaning of deploy in 1 word...

English, 4 months ago

Choose the correct meaning of the proverbs ."All that glitters is not gold." All good looking things are genuine All good looking things are not genuine None of these...

Math, 9 months ago

ten numbers mean is M. if 5 added to each number then the mean becomes 12.5. then the total of original numbers...

History, 9 months ago

who is the president of west indies...

Geography, 1 year ago

Which place has achieved a race distinction of having root top rain water harvesting in every house ? a) Gujarat b) Gendathur c) Rajasthan d) Tamil nadu...

Biology, 1 year ago

(0.68. Following sequence of RNA, when translated will form a protein molecule of amino acids. 5 GCUCGCAUGCCAGAUGUCUUCGUCCUUUAGUUUAUUAGA 3' a) 3 b) 7 c) 6 d) 9...

Physics, 1 year ago

In the figure shown the minimum value of F to be applied perpendicular to the inclined so that the block of mass 10 kg does not slides and remains in contact with inclined plane is (A)0 (B) 40 N (C) 220 N (D) 200 N ...