Hindi, asked by misbahzen786, 1 month ago

राम कल मेरे घर आया। translate in sanskrit

Answers

Answered by XxitzCottonCandyxX

0

I'm so Sorry I couldn't understand Sanskrit I'm very weak in Sanskrit..

Previous Question

Next Question

Similar questions

Physics, 18 days ago

A lamp is connected in series with a capacitor to a high frequency AC source. Then it is connected directly to the same source which is true statement about this. * 1 point (a) Lamp will glow more brightly when the capacitor is in series with it. (b) Lamp will glow more brightly on connecting it directly to the source. (c) Lamp glows with same brightness in both cases. (d) Brightness of glow of...

English, 18 days ago

when dad come home passage quedtion with answer...

English, 18 days ago

XV. Underline the abstract nouns: 1.He takes pride in his job. 2.King Solomon was a man of wisdom.

English, 1 month ago

write about the thrill of an unexpected experience in your life.Narrate the details of the experience and say why it has become memorable in your life in 250 words...

Math, 1 month ago

what is once tense define it...

Economy, 9 months ago

In monopoly firm the numbers of firm is..................................

Computer Science, 9 months ago

Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm?

Geography, 9 months ago

How is the title important in a map?