Hindi, asked by dipikabenjani12, 4 days ago

स्पस्ध

opposite of word

please tell me fast

it is arrgent

Answers

Answered by pushpadevisakshi1991

0

Answer:

It will be (स्पष्ट) not (स्पस्ध)

it's opposite will be (अस्पष्ट)

Explanation:

hope it will help you

plz mark me as the brainliest

Previous Question

Next Question

Similar questions

Math, 2 days ago

MCOS 6. In n th 1. Zinc and Nickel are melted and mixed together in the ratio 10:17. What is the weight of the melted mixture, if 30 kg of Zinc has been consumed in it? a) 51 kg b) 79 kg c) 81 kg d) 210 kg a c 7.

Biology, 2 days ago

2. What will be the sequence of the transcribed RNA molecule from given double stranded DNA segment? Define the polarity of these two strands as well as of the transcribed mRNA. CGATGCCTAACGACATGCGTCATTGG GCTACGGATTGCTGTACGCAGTAACC...

Math, 2 days ago

what is the additive inverse of rational number -p upon q solution ...

English, 4 days ago

what is eroitic in hindi?

Math, 4 days ago

Sides of traingle in terms of x are 2xratio2-x+3,x ratio2+3x-9 find its perimeter...

Hindi, 8 months ago

please tell answer to this question परिवार शब्द __________ संज्ञा का उदाहरण है। 1. समूहवाचक 2. भाववाचक it is tick the correct amswer ...

Math, 8 months ago

List the first five multiples of 16.

History, 8 months ago

thought pollution is the root causes for all ills in 500 word in paragraph ...