English, asked by suvarahul5620, 4 months ago

The culprits are not being punished change into active

Answers

Answered by justuniqueideas

1

Answer:

The culprits will not be punished.

Answered by rrmeena2010

1

Answer:

The culprits will not be punished

Previous Question

Next Question

Similar questions

Social Sciences, 2 months ago

How did man use the percussion technique?

Math, 2 months ago

The book price written as Rs 60.If the commission is 10% still seller gets profit of 20% .Find the cost price of the book?

Science, 2 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 a.. What would be the first 5 bases in the 3 end of the complementary strand? b.. What would be the 10 bases of the 5 end of the complementary strand?

Social Sciences, 4 months ago

In china oracle bones were used to predict the future...

Chemistry, 4 months ago

Vzvmsmvsjggwkgajgangamyamhsmhamhanhwyaamtangananajamgajywkyabcadagegrq uwiyskhsjsjhamhakyakywl ekuwkualyhangagkw This is my question This is real question can you decode this...

Math, 9 months ago

a regular octagon of side 45 cm. the perimeter of each of the following figures...

Science, 9 months ago

which chemical reaction is involved in the white washing of walls .Aslo write the chemical equation for the reaction...

Social Sciences, 9 months ago

mention two regional newspaper during british period ...