English, asked by alokgupta6850, 1 month ago

the teacher asked him what was he doing

Answers

Answered by narendrapatel5152np4

0

Answer:

He what asked doing him the teacher

Previous Question

Next Question

Similar questions

English, 21 days ago

May I hope that these books will be dispatched at an early date? (Underline the Phrase in the sentence and mention whether it is Noun Phrase, Adjective Phrase or Adverb Phrase)...

Math, 21 days ago

B) State following statements True or False (1) Diameter is the chord which passes through the centre of the circle (2) Measure of a circle is 180°...

Science, 21 days ago

what type of soup can be served either hot or cold...

Computer Science, 1 month ago

provide the facility of calculator.

English, 1 month ago

Hlo guys don't deleted the question plz plz plz plz plz plz plz plz plz plz plz plz ...

Science, 8 months ago

why pumpkin are not ingredients of preparing chicken curry? explain...

Biology, 8 months ago

write three advantages of selecttive preamble...

Biology, 8 months ago

Look at the following short strand of DNA: CCTGTATGTTCTGAATAATGCTTATGCCTAATGAC What is the first gene found in it?