English, asked by alokgupta6850, 6 months ago

the teacher asked him what was he doing

Answers

Answered by narendrapatel5152np4

0

Answer:

He what asked doing him the teacher

Previous Question

Next Question

Similar questions

Science, 3 months ago

Which place is lower Attitude kolkata/chennai...

English, 3 months ago

Mrs verma is a teacher.teacher is a ______ gender. please answer fast.

Math, 3 months ago

योग पर गुणन का विवरण गुणधर्म प्रयोग कर सकते -49X18...

Computer Science, 6 months ago

provide the facility of calculator.

English, 6 months ago

Hlo guys don't deleted the question plz plz plz plz plz plz plz plz plz plz plz plz ...

Science, 1 year ago

why pumpkin are not ingredients of preparing chicken curry? explain...

Biology, 1 year ago

write three advantages of selecttive preamble...

Biology, 1 year ago

Look at the following short strand of DNA: CCTGTATGTTCTGAATAATGCTTATGCCTAATGAC What is the first gene found in it?