Social Sciences, asked by Negijanki3162, 1 year ago

Theorem proving example using resolution

Answers

Answered by vennilag22Krish

Basic proportionality theorem
If a straight line is drawn parallel to one side of triangle intersecting the other two sides then it divides.the line in same ratio

Previous Question

Next Question

Similar questions

Math, 7 months ago

hi simplify this question...

Economy, 7 months ago

In monopoly firm the numbers of firm is..................................

Computer Science, 7 months ago

Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm?

Math, 1 year ago

The number of integral divisors of 720 is...

Math, 1 year ago

The length of a given cylindrical wire is increased by 100%. due to the consequent decrease in diameter, the change in the resistance of the wire will be...

Geography, 1 year ago

How do himalaya influence the climate of india...

English, 1 year ago

He can't help you (change into passive voice )...

Chemistry, 1 year ago

Does Potassium dicromate react with alkenes ??