Chemistry, asked by chetanmourya452, 15 hours ago

1) एक वाष्पशील पदार्थ के 10.0 ग्राम को 100 ग्राम जल में घोलने पर इसके हिमांक में अवनमन 1.2C है तो पदार्थ का अणुभार ज्ञात कीजिये।

Answers

Answered by dalalsameer341

0

Answer:

sorry hdhdhdhhfhf

Explanation:

i dont no jdjrjd

Previous Question

Next Question

Similar questions

Math, 8 hours ago

C. Add a subject from the box to complete each sentences. 2. ran happlily across the playround. 3. chased the rabbit into its burrow. 4. were made of good leather and embroidered with gold...

English, 8 hours ago

He has sold him house meaning in hindi...

Sociology, 8 hours ago

famines were also a major and recurring sources of increased mortality ?critically evaluate this statement.

English, 15 hours ago

Complete the sentences with appropriate prepositions. 1. Put your binoculars in the tote___the camera and the map. 2. When you leave___school, bring your tablet home. 3. Emily gathers wild flowers from___the bank of the stream or the woods. 4. All the information that you need___woodpeckers for your project work is here in this encyclopedia. 5. The cottage was___a complete mess when the new...

Math, 15 hours ago

Find the roots of the following quadratic equations, if they exist, by the method of completing the square: (i) 2x2 – 7x + 3 = 0 (ii) 2x2 + x – 4 = 0 (iii) 4x2 + 4√3x + 3 = 0 (iv) 2x2 + x + 4 = 0 Solve this of Class 10...

English, 7 months ago

how does Dr Chanda react and what does he suggest Bipin Babu should do?

Science, 7 months ago

who invented exam?

Biology, 7 months ago

Assume you are using PCR (polymerase chain reaction) to make multiple copies of a target gene. The primers that flank the gene are 5'ATGTT3' and 3'CCATT5'. The DNA sequence containing the gene of interest is: 3' TACAAAGACTTACAAATTTGTCCCCATTTTGC 5' 5' ATGTTTCTGAATGTTTAAACAGGGGTAAAACG 3' Answer the following questions to describe the overall process and insert the diagran of the results you would...