Math, asked by dhruvwadhwa07, 2 months ago

What is the mistake in this solution

Attachments:

Answers

Answered by gaylian301987

0

Answer:

What is the product of 6.98 x 0.1?

A.0.0698

B.0.698

C.6.98

D.69.80

Need help? Answer pwease?

Previous Question

Next Question

Similar questions

Science, 1 month ago

what things we're different in kingdom of fools?

Computer Science, 1 month ago

string is a set of characters true hai ya false ...

English, 1 month ago

2. Bravo! A nice kick. (Assertive) Just Change into assertive sentence it's wrong u have to change...

Chemistry, 2 months ago

1) एक वाष्पशील पदार्थ के 10.0 ग्राम को 100 ग्राम जल में घोलने पर इसके हिमांक में अवनमन 1.2C है तो पदार्थ का अणुभार ज्ञात कीजिये। ...

English, 2 months ago

Complete the sentences with appropriate prepositions. 1. Put your binoculars in the tote___the camera and the map. 2. When you leave___school, bring your tablet home. 3. Emily gathers wild flowers from___the bank of the stream or the woods. 4. All the information that you need___woodpeckers for your project work is here in this encyclopedia. 5. The cottage was___a complete mess when the new...

English, 10 months ago

how does Dr Chanda react and what does he suggest Bipin Babu should do?

Science, 10 months ago

who invented exam?

Biology, 10 months ago

Assume you are using PCR (polymerase chain reaction) to make multiple copies of a target gene. The primers that flank the gene are 5'ATGTT3' and 3'CCATT5'. The DNA sequence containing the gene of interest is: 3' TACAAAGACTTACAAATTTGTCCCCATTTTGC 5' 5' ATGTTTCTGAATGTTTAAACAGGGGTAAAACG 3' Answer the following questions to describe the overall process and insert the diagran of the results you would...