Science, asked by amitsangar479, 10 months ago

7. Catilage is not Found In

Answers

Answered by 1brainking

0

Answer:

cartilage is found in knees

Answered by swatipatil1650

0

Answer:

catilage

Explanation:

so this a screen shot of the catilage

Attachments:

Previous Question

Next Question

Similar questions

Science, 5 months ago

ii. Assume the following base sequence was found in a 20 base DNA strand: 3ATTCGACCTTATTACTGCAC5 a.. What would be the first 5 bases in the 3 end of the complementary strand? b.. What would be the 10 bases of the 5 end of the complementary strand?

Math, 5 months ago

0.) Identin the solids whose nets are given below. c) b) d)...

Math, 5 months ago

a bag contains cards numbered from 1 to 49. a card is drawn from the bag at random. find the probability that the card drawn is a) natural number less than 50 b) a number x such that 50<x<100.

Physics, 10 months ago

A body moving with uniform speed, may or not move with uniform velocity-justify your answer...

India Languages, 10 months ago

Whe below and the respect the dela Does or the me want the Mathi the wa bwand e triangle Find the points of or the web...

Science, 1 year ago

Math, 1 year ago

find the value of x such that PQ is equal to give the coordinates of p, 6, - 11, 3 and 8 respectively...

Math, 1 year ago

The ages of Sheemaz and Sohaib are in the ratio of 5:7 . Four years later, the sum of their ages will be 56 years. What are their present ages ?