Math, asked by prshree, 1 year ago

Anil deposited Rs.8000 in a bank after two years he withdraws rs.3000. After four years he receives an amount of rs.6800. Find the rate of interest.

Answers

Answered by khangembamgojen

3

Answer:

Step-by-step explanation:

S.I +P -3000=6800

Previous Question

Next Question

Similar questions

Social Sciences, 6 months ago

The great queen of Anhilpor Patan... defeated Shahba laddin ghoori...

Geography, 6 months ago

what is the deferent between aquifer and aquaclude?

English, 6 months ago

who does not know this simple game?(use a full stop instead of question mark...

Hindi, 1 year ago

please find the answer to the question s...

Chemistry, 1 year ago

which god do you like more . bhagwan Osho ,bhagwan ram ,bhagwan budha ,bhagwan krishna ,bhagwan mahavir ,bhagwan jaggi vasudev .

Math, 1 year ago

If the sum of a number and its reciprocal be 2 then the number is...

Physics, 1 year ago

If the speed of a dc motor increases with load torque then it is a...

Biology, 1 year ago

If the sequence of the coding strand in a transcription unit is written as follow :5' atgcatgcatgcatgcatgcatgcatgc3'.write down the sequence of mrna...