Math, asked by prshree, 1 year ago

Anil deposited Rs.8000 in a bank after two years he withdraws rs.3000. After four years he receives an amount of rs.6800. Find the rate of interest.

Answers

Answered by khangembamgojen

3

Answer:

Step-by-step explanation:

S.I +P -3000=6800

Previous Question

Next Question

Similar questions

Business Studies, 6 months ago

Zenon Ltd. is a cellphone manufacturing company which has performed well in the past. But recently the firm faced tough competition from foreign brands and could not cope up with the revenues and hence for a long time the company could not cover its cost. Ultimately, after a series of financial set-backs the company shut down its operations. identify the organizational objective which the...

Biology, 6 months ago

what is the capital of Indonesia...

English, 6 months ago

Write a diary entry expressing your feelings when a scientist visited your school i will mark you brainliest ✌✌...

Hindi, 1 year ago

please find the answer to the question s...

Chemistry, 1 year ago

which god do you like more . bhagwan Osho ,bhagwan ram ,bhagwan budha ,bhagwan krishna ,bhagwan mahavir ,bhagwan jaggi vasudev .

Math, 1 year ago

If the sum of a number and its reciprocal be 2 then the number is...

Physics, 1 year ago

If the speed of a dc motor increases with load torque then it is a...

Biology, 1 year ago

If the sequence of the coding strand in a transcription unit is written as follow :5' atgcatgcatgcatgcatgcatgcatgc3'.write down the sequence of mrna...