Hindi, asked by na8, 1 year ago

please find the answer to the question s

Attachments:

Answers

Answered by nishu5899

0

hope it will help you

Attachments:

Previous Question

Next Question

Similar questions

Art, 6 months ago

yadi hb pencil se drawing karte hai to 2B,4Bpencil se Kya karte hai...

Math, 6 months ago

find the least number which when divided by 12 15 20 and 54 leaves a remainder...

Science, 6 months ago

Illustrate how the particles of matter are arranged in the following objects. Do it in your Science journal or notebook.

Chemistry, 1 year ago

which god do you like more . bhagwan Osho ,bhagwan ram ,bhagwan budha ,bhagwan krishna ,bhagwan mahavir ,bhagwan jaggi vasudev .

Science, 1 year ago

What is the reason for +I effect in alkyl groups?

Math, 1 year ago

If the sum of a number and its reciprocal be 2 then the number is...

Physics, 1 year ago

If the speed of a dc motor increases with load torque then it is a...

Biology, 1 year ago

If the sequence of the coding strand in a transcription unit is written as follow :5' atgcatgcatgcatgcatgcatgcatgc3'.write down the sequence of mrna...