Math, asked by manjuvkp123, 1 month ago

if the number 4n isend with digit 6,n belongs to N, then the value of n is
what

Answers

Answered by cutiemiss029

1

Answer:

2700fgi brook mssbdidnrjjrhfhfhdhrbdhenirjhfufhtjt

Previous Question

Next Question

Similar questions

Hindi, 17 days ago

मुझे ध्वनि पाठ में क्या चुनौतीपूर्ण लगा ?

Math, 17 days ago

MCOS 6. In n th 1. Zinc and Nickel are melted and mixed together in the ratio 10:17. What is the weight of the melted mixture, if 30 kg of Zinc has been consumed in it? a) 51 kg b) 79 kg c) 81 kg d) 210 kg a c 7.

Biology, 17 days ago

2. What will be the sequence of the transcribed RNA molecule from given double stranded DNA segment? Define the polarity of these two strands as well as of the transcribed mRNA. CGATGCCTAACGACATGCGTCATTGG GCTACGGATTGCTGTACGCAGTAACC...

Math, 1 month ago

in the given figure name is liner part of angles and pair of vertically opposite angle: Ugent fast Class 7...

English, 1 month ago

Frame meaningful sentences using the following carry on (project, work, good service)...

Geography, 9 months ago

____________ occurs in areas where the temperature drops below 0 degree c...

Math, 9 months ago

2+2equal to _........................

English, 9 months ago

what can be the matter now) > turn into assertive ...