English, asked by coz66, 1 month ago

___(most/several) students have passed the examination this year

Answers

Answered by ImpressAgreeable4985

1

Answer:

Most

Explanation:

Most__(most/several) students have passed the examination this year

Answered by Ikshasoni10

0

Answer:

Most is the correct answer

Previous Question

Next Question

Similar questions

English, 17 days ago

Why are the spirits of Truth compared to the birds that sing ? ANSWER The spirits of Truth are compared to the birds that sing because they spread their positive vibrations wherever they go.

Hindi, 17 days ago

अलिंकार सधचत्र वर्धन ...

Math, 17 days ago

akndo Sana Samua upojutko katra >=< Chino dou quason 2+(-2)_(-3)+(-6)...

Chemistry, 1 month ago

A metal X displaces metal Y from Y2(SO4)3(aq).Which metal is more reactive X or Y ?

English, 1 month ago

Give me answer please ...

Math, 9 months ago

hi simplify this question...

Economy, 9 months ago

In monopoly firm the numbers of firm is..................................

Computer Science, 9 months ago

Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm?