Chemistry, asked by sakshich1004, 1 month ago

A metal X displaces metal Y from Y2(SO4)3(aq).Which metal is more reactive X or Y ?

Answers

Answered by pabitrakumargouda11

1

Answer:

Metal X

Explanation:

The metal which displaces the other metal from its salt solution is said to be more reactive. Here X is more reactive as it displaces Y.

Previous Question

Next Question

Similar questions

Math, 17 days ago

PA DATE a राम ने 40 पुतल-11260 श्वर ढो में रक्खेदी- पुस्तम मासत मुल्प...

Math, 17 days ago

State the division lemma for polynomials. Urgent answer please...

Biology, 17 days ago

What is the pesticide used to kill unwanted plants...

English, 1 month ago

Give me answer please ...

Hindi, 1 month ago

राम कल मेरे घर आया। translate in sanskrit...

Math, 9 months ago

hi simplify this question...

Economy, 9 months ago

In monopoly firm the numbers of firm is..................................

Computer Science, 9 months ago

Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. Consider the following DNA string. “AAATGCCCTAACTAGATTAAGAAACC” Which one of the following is the gene returned using that algorithm?