Math, asked by samikshitghule11, 1 month ago

what is the nature of root -4/5

Answers

Answered by ibrahim6356

0

Answer:

1

Step-by-step explanation:

jdur363y3y3hrv3bowiwwiwieiekekeu3i3ibdyd3t36353536364y4ubzb goBack OutWith

Previous Question

Next Question

Similar questions

Math, 19 days ago

MCOS 6. In n th 1. Zinc and Nickel are melted and mixed together in the ratio 10:17. What is the weight of the melted mixture, if 30 kg of Zinc has been consumed in it? a) 51 kg b) 79 kg c) 81 kg d) 210 kg a c 7.

Biology, 19 days ago

2. What will be the sequence of the transcribed RNA molecule from given double stranded DNA segment? Define the polarity of these two strands as well as of the transcribed mRNA. CGATGCCTAACGACATGCGTCATTGG GCTACGGATTGCTGTACGCAGTAACC...

Math, 19 days ago

what is the additive inverse of rational number -p upon q solution ...

Math, 1 month ago

please help anybody who can answer is like 3S,6S,8S...

Hindi, 1 month ago

explain briefly no spam⌐╦╦═─ what is magnificent→_→...

English, 9 months ago

Identify the prepositional phrase in the given sentence: "we all were surprised at the news".

Science, 9 months ago

Depletion of ozone layer is mainly caused due to presence of :-a) No2 b) co2 c)So2 d)none of these...

Chemistry, 9 months ago

1. Difine atomic radius? How to change atomic radius in group and period?what are factors effect on the atomic radius?