Math, asked by kashish0480, 10 months ago

✍️ (25²) write the following as the sum of two consecutive positive numbers

Answers

Answered by kritika5851

3

Answer:

312 and 313

Step-by-step explanation:

(25)^2=625

312+313=625

Previous Question

Next Question

Similar questions

English, 5 months ago

(1) Write a letter to your friend discussing about features of the summer camp and inviting him for joining it.

Physics, 5 months ago

I NEED HELP PLEASE!!!!!!!!!!!! HURRY UP PLEASE!!!!!

Biology, 5 months ago

*Q1. You have the following sequence on a plasmid: 5′- ATGCTAGCAGAATTCTAGCTACGAT (only one of the strands is shown) You cleave the region indicated (in bold) with the appropriate restriction enzyme, then fill in the overhangs with DNA polymerase, ligate, and reclone. You then aliquot the resulting DNA to three. In the first tube, digest the plasmid DNA with XmnI (recognition sequence...

Geography, 10 months ago

i need 10 sentences on extreme weather...

Math, 10 months ago

draw a graph for the equation x-3y-6=0...

Physics, 1 year ago

The energy associated per molecule per degree of freedom is...

Physics, 1 year ago

Two identical masses of 5 kg each fall on a wheel from a height of 10m will disturb the mass of 2 kg water the rise in the temperature of the water will be...

Math, 1 year ago

Two angles of a quadrilateral are 75° and 115°.The otger two angles are equal.Find the measure of each equal angle.