Math, asked by manishajain620, 1 month ago

If base radius of a cylinder is decreased by 25% and height is increased by 10%, then find the increase or decrease in its volume

Answers

Answered by yashkumar14122001

0

Step-by-step explanation:

◇r/r=25

◇h/h==10

◇V/V==2×25+10=60

join channel https://t.me/iitjeeneetcollege

Previous Question

Next Question

Similar questions

Hindi, 17 days ago

मुझे ध्वनि पाठ में क्या चुनौतीपूर्ण लगा ?

Math, 17 days ago

MCOS 6. In n th 1. Zinc and Nickel are melted and mixed together in the ratio 10:17. What is the weight of the melted mixture, if 30 kg of Zinc has been consumed in it? a) 51 kg b) 79 kg c) 81 kg d) 210 kg a c 7.

Biology, 17 days ago

2. What will be the sequence of the transcribed RNA molecule from given double stranded DNA segment? Define the polarity of these two strands as well as of the transcribed mRNA. CGATGCCTAACGACATGCGTCATTGG GCTACGGATTGCTGTACGCAGTAACC...

Math, 1 month ago

What will be the differential x relative to the equation x2+2x+2=0...

Math, 1 month ago

In the equation shown, >0 −(+)+−=−. The equation when expressed in the form ++=0 gives = 6. What are the values of and ? * 1 point = 2 and = −3 = -2 and = 3 = -1 and = 1 = 2 and = 1...

Social Sciences, 9 months ago

what is the amount of urine is formed per day?

Math, 9 months ago

please solve all the above questions my paper is going on my paper has time limit of 1 hour please solve fast...

Math, 9 months ago

prove that sintheeta /1 +costheeta+1+costheeta/sin theeta=2 cosectheeta ...