Math, asked by piyanshi12, 1 year ago

simplify (1÷2×5)+(1÷3×6)+(1÷4×7)+...(1÷n(n+3))+...

Answers

Answered by kushagrh9191

1

Answer:

follow me on insta @kushagrh8

Step-by-step explanation:

Answer of n will be on insta

Previous Question

Next Question

Similar questions

English, 6 months ago

(1) Write a letter to your friend discussing about features of the summer camp and inviting him for joining it.

Physics, 6 months ago

I NEED HELP PLEASE!!!!!!!!!!!! HURRY UP PLEASE!!!!!

Biology, 6 months ago

*Q1. You have the following sequence on a plasmid: 5′- ATGCTAGCAGAATTCTAGCTACGAT (only one of the strands is shown) You cleave the region indicated (in bold) with the appropriate restriction enzyme, then fill in the overhangs with DNA polymerase, ligate, and reclone. You then aliquot the resulting DNA to three. In the first tube, digest the plasmid DNA with XmnI (recognition sequence...

English, 1 year ago

50 verbs in 1st form 2 nd or 3rd in english...

Chemistry, 1 year ago

Vasuli Khata kya hai ...

Math, 1 year ago

The perimeter of a triangle is 240m and two of its sides measure 50m and 112m. Find the area of the triangle and the length of the perpendicular on the side 112m from the opposite vertex. Pls explain in detail.

CBSE BOARD XII, 1 year ago

how can i score good marks in my jee april exam about 97 percentile Considering my earlier result was 84.2 percentile...

Physics, 1 year ago

Can a body be translational and rotational motion ? Give some examples .